Informe de becario
Acceso Abierto

Informe científico de Beca de Estudio: Torres, María Celeste (2013-2014) 

Enlace externo

Con el objetivo de realizar una caracterización molecular del virus de las hepatitis B (HBV) circulante en la ciudad de Mar del Plata, se analizaron muestras de 44 pacientes provenientes de instituciones de salud pública de la ciudad. Todos los sueros presentaban marcadores serológicos positivos para el diagnóstico de la infección por HBV (anticuerpos anti-HBc y HBsAg). El DNA viral fue extraído a partir de 200 μL de suero, empleando el QIAamp DNA Mini Kit (Qiagen, Valencia, CA), de acuerdo a las instrucciones del fabricante. Dos regiones del genoma viral fueron amplificadas mediante nested PCR: la región del gen S (76-791 nucleótidos) y la región comprendida entre el gen X, BCP (promotor basal del core) y el PC (pre-core) (1260-1976 nucleótidos). En todas las reacciones controles positivos y negativos se largaron juntamente con las muestras a analizar . Para la amplificación del gen S se emplearon los primers 37S (5’ TTTTTCACCTCTGCCTAATCATC 3’) y 40AS (5’ AAAAAGTTGCATGGTGCTGG 3’) para la primer ronda, y los primers 27S (5’ CTGCTGGTGGCTCCAGTTC 3’) y 26AS (5’ AGAAAATTGGTAACAGMGGYA 3’) para la segunda ronda de amplificación. La primer ronda se realizó con 5 μL de DNA en un volumen final de 25 μL, bajo las siguientes condiciones de ciclado: 5’ a 94 °C, 10 ciclos de: 94 °C 1’, 61 °C 2’ y 72 °C 3’, seguido de 10 ciclos de: 94 °C 1’, 61 °C 2’ y 72 °C 5’, seguido de 10 ciclos de: 94 °C 1’, 61 °C 2’ y 72 °C 7’ y 6 ciclos de: 94 °C 1’, 61 °C 2’ y 72 °C 9’, finalizando con 15’ a 72 °C.

Palabras clave

Esta obra se publica con la licencia Creative Commons Attribution 4.0 International (BY 4.0)
Imagen en miniatura